|
Sino Biological
plasmid encoding sod2 ![]() Plasmid Encoding Sod2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid encoding sod2/product/Sino Biological Average 94 stars, based on 1 article reviews
plasmid encoding sod2 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
R&D Systems
mnsod ![]() Mnsod, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mnsod/product/R&D Systems Average 93 stars, based on 1 article reviews
mnsod - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Cusabio
sod2 ![]() Sod2, supplied by Cusabio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sod2/product/Cusabio Average 92 stars, based on 1 article reviews
sod2 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Cusabio
superoxide dismutase ![]() Superoxide Dismutase, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/superoxide dismutase/product/Cusabio Average 93 stars, based on 1 article reviews
superoxide dismutase - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Boster Bio
uperoxide dismutase sod2 ![]() Uperoxide Dismutase Sod2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/uperoxide dismutase sod2/product/Boster Bio Average 91 stars, based on 1 article reviews
uperoxide dismutase sod2 - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Proteintech
rabbit anti human sod2 ![]() Rabbit Anti Human Sod2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti human sod2/product/Proteintech Average 96 stars, based on 1 article reviews
rabbit anti human sod2 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Genechem
adenovirus encoding the human sod2 gene ![]() Adenovirus Encoding The Human Sod2 Gene, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adenovirus encoding the human sod2 gene/product/Genechem Average 90 stars, based on 1 article reviews
adenovirus encoding the human sod2 gene - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
OriGene
mouse sod2 forward 50 taacgcgcagatcatgcagctg ![]() Mouse Sod2 Forward 50 Taacgcgcagatcatgcagctg, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse sod2 forward 50 taacgcgcagatcatgcagctg/product/OriGene Average 99 stars, based on 1 article reviews
mouse sod2 forward 50 taacgcgcagatcatgcagctg - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Proteintech
anti human mouse sod2 ![]() Anti Human Mouse Sod2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti human mouse sod2/product/Proteintech Average 96 stars, based on 1 article reviews
anti human mouse sod2 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
Journal: Redox Biology
Article Title: Noninvasive in vivo discrimination between mitochondrial ROS and global ROS production in solid tumors using EPR spectroscopy
doi: 10.1016/j.redox.2025.103871
Figure Lengend Snippet: Contribution of superoxide to the EPR signal decay rate in vivo. (A) Western blot of expression of SOD2 in wild-type 4T1 breast cancer cell and 4T1 cells transfected with a plasmid encoding SOD 2, after passages 1, 4 and 6. Student's t-test, n = 3, ∗∗; p < 0.01 (B) Decay rates of nitroxides in vivo for 4T1-SOD2 tumors compared to wild-type 4T1 tumors. Bars represent means ± SEM. n = 6/group, Student's t-test, ∗; p < 0.05. (C) EPR signal decay of MitoTEMPO (25 μmol/kg) in vivo. Points represent means ± SEM. n = 6/group, two-way ANOVA with Sidak's correction, ∗; p < 0.05.
Article Snippet: Lipofectamine (Thermo Scientific, Merelbeke, Belgium) was used in antibiotic-free media to transfect a
Techniques: In Vivo, Western Blot, Expressing, Transfection, Plasmid Preparation
Journal: Animal Cells and Systems
Article Title: Epinephrine as a potential driver of oral lichen planus pathogenesis
doi: 10.1080/19768354.2025.2588914
Figure Lengend Snippet: High level of epinephrine induces intracellular oxidative stress in oral keratinocytes. (A) HOK-16B cells treated with PBS or epinephrine for 24 h were subjected to CellROX staining. Nuclear DAPI signal is shown in blue (left). The relative CellROX signal intensities are shown (right). Each symbol means an individual cell. (B) Immunoblot analysis of SOD2 and SESN2 in HOK-16B cells treated with epinephrine for 24 h. β ACTIN was used as loading control. (C) Relative band intensities are shown. (D) Relative mRNA expression of TNFα, IL6, and IL8 in HOK-16B cells treated with epinephrine for 3 h. ** P < 0.01; *** P < 0.001. n.s , not significant.
Article Snippet: After blocking with 5% non-fat dried milk in Tris-buffered saline with TweenTM 20 (TBST) (10 mM Tris, pH 8.0, 150 mM NaCl and 0.5% Tween 20) for 30 min, membranes were incubated with antibodies against phospho STAT3 (1:1000, Cell signaling, Danvers, MA, USA, cat no. 9145), total STAT3 (1:1000, Cell signaling, cat no. 8768), β ACTIN (1:5000, Sigma Aldrich, cat no. A5316), phospho ERK (1:1000, Thermo Fisher Scientific, Waltham, MA, USA, cat no. MA5-15174), total ERK (1:1000, Cell signaling, cat no. 4695), phospho AKT (1:1000, Cell signaling, cat no. 4058), total AKT (1:1000, Cell signaling, cat no. 9272), BCL2 (1:1000, Bioworld Technology, China, cat no. BS1511),
Techniques: Staining, Western Blot, Control, Expressing
Journal: Scientific reports
Article Title: Probing the molecular mechanism of kaempferol in relieving rheumatoid arthritis based on network pharmacology.
doi: 10.1038/s41598-025-91311-6
Figure Lengend Snippet: Fig. 7. Kaempferol inhibits autophagy and attenuates oxidative stress in RA-FLS cells. (A) RA-FLS cells were treated with different concentrations of kaempferol, cellular reactive oxygen species were detected by DCFH- DA, and cell membrane potential was detected by JC-1, Scale bar is 100 μm. (B) RA-FLS cells were treated with different concentrations of kaempferol and protein expression of SOD2 was detected by Western blot. (C) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of P62, LC3B. *P < 0.05; **P < 0.01; ***P < 0.001.
Article Snippet: After electrophoresis, the SDS-PAGE gel was removed, and a polyvinylidene difluoride membrane (PVDF, Merck Millipore, Germany) was activated and placed on the top layer of the gel, and the blot was transferred to the PVDF membrane by electrotransferring the blot at 200 mA for 2 h. Subsequently, the membranes were blocked with 5% skimmed milk for 2 h. Antibodies including glyceraldehyde-3-phosphate dehydrogenase(GAPDH) (Proteintech, #60,004–1-IG), phosphor-mitogen-activated protein kinase (P-MAPK) (Wanleibio, #WL01813), mitogen-activated protein kinase (MAPK) (Wanleibio, #WL05246), peroxisome proliferator-activated receptor gamma (PPARG) (Wanleibio, #WL01800), phosphor-nuclear factor kappa-light-chain-enhancer of activated B cells (P-NFKB) (Wanleibio, #WL02169), NFKB (Bioss, # bsm-33117 M), NLRP3 (Bioss, #bs-41293R), IL1β (Wanleibio, #WLH3903),
Techniques: Membrane, Expressing, Western Blot
Journal: Scientific reports
Article Title: Probing the molecular mechanism of kaempferol in relieving rheumatoid arthritis based on network pharmacology.
doi: 10.1038/s41598-025-91311-6
Figure Lengend Snippet: Fig. 8. Kaempferol inhibits cellular autophagy through the MAPK8/NLRP3 pathway to attenuate the abnormal proliferation and inflammation of RA-FLS. (A) Different concentrations of kaempferol were treated with RA- FLS cells, and the protein expression of P-MAPK8 and MAPK8 were detected by Western blot. (B) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β. (C) Overexpression of MAPK8 and kaempferol treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β, PCNA, SOD2. (D) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of LC3B protein expression, Scale bar is 50 μm. (E) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of P62 protein expression, Scale bar is 50 μm. *P < 0.05; **P < 0.01; ***P < 0.001.
Article Snippet: After electrophoresis, the SDS-PAGE gel was removed, and a polyvinylidene difluoride membrane (PVDF, Merck Millipore, Germany) was activated and placed on the top layer of the gel, and the blot was transferred to the PVDF membrane by electrotransferring the blot at 200 mA for 2 h. Subsequently, the membranes were blocked with 5% skimmed milk for 2 h. Antibodies including glyceraldehyde-3-phosphate dehydrogenase(GAPDH) (Proteintech, #60,004–1-IG), phosphor-mitogen-activated protein kinase (P-MAPK) (Wanleibio, #WL01813), mitogen-activated protein kinase (MAPK) (Wanleibio, #WL05246), peroxisome proliferator-activated receptor gamma (PPARG) (Wanleibio, #WL01800), phosphor-nuclear factor kappa-light-chain-enhancer of activated B cells (P-NFKB) (Wanleibio, #WL02169), NFKB (Bioss, # bsm-33117 M), NLRP3 (Bioss, #bs-41293R), IL1β (Wanleibio, #WLH3903),
Techniques: Expressing, Western Blot, Over Expression, Immunofluorescence
Journal: Frontiers in Immunology
Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis
doi: 10.3389/fimmu.2024.1474673
Figure Lengend Snippet: Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level c4_SOD2 in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.
Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA),
Techniques: Fluorescence, Staining, Biomarker Discovery, Expressing
Journal: Frontiers in Immunology
Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis
doi: 10.3389/fimmu.2024.1474673
Figure Lengend Snippet: Docking results of available proteins with small molecules.
Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA),
Techniques: Binding Assay
Journal: Frontiers in Immunology
Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis
doi: 10.3389/fimmu.2024.1474673
Figure Lengend Snippet: Molecular docking results of predicted drugs and protein encoded by target genes. (A) PDGFRβ and docetaxel. (B) TYMS and docetaxel. (C) PDGFRβ and cytarabine. (D) TYMS and cytarabine. (E) PDGFRβ and bisindolylmalemide. (F) SOD2 and bisindolylma-leimide. (G) PDGFRβ and raloxifene. (H) SOD2 and raloxifene.
Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA),
Techniques:
Journal: bioRxiv
Article Title: Human adipose-derived mesenchymal stromal cells improved wound healing in enterocutaneous fistulizing disease mouse model
doi: 10.1101/2024.11.07.622127
Figure Lengend Snippet: GeoMx DSP was used to concurrently analyze the transcriptome of stationary and reactive AT-MSC in FFPE tissue sections obtained from 3 weeks after transplantation in the tissues around the fistula wound. GeoMx gene expression data of AT-MSC was analyzed for cell classification using xCell (C). Pre-ranked GSEA analysis was conducted using the GSEA software (GSEA 4.1.0) and results are presented in dot plot D. Positive normalized enrichment scores (NES) are enriched in reactive AT-MSC (D) while negative NES are enriched in stationary AT-MSC (D). Pathway enrichment analysis using STRING was applied to all significantly downregulated genes (blue data points in A-B), which are up regulated in stationary cells (n=115; adjP-Value < 0.05) and results are presented in dot plot E. Expression of SOD2 in AT-MSC is further validated using immunofluorescence staining in F-G. Representative images of AT-MSC in the fistula tract expressing eGFP in green, nuclear staining with DAPI in blue and anti-SOD2 in red. Colocalization of SOD2 (white in G) and GFP (green in G) in AT-MSC was demonstrated using confocal microscopy. The xy image is on the plan indicated by the horizontal and vertical lines shown in the xz and yz images, respectively, and the original magnification was X40 (G). Scale bars: 100µm (F), and 10µm in G.
Article Snippet: Incubation with primary antibodies included: rabbit anti-human CD45 (1:25) (Abcam, Cambridge, UK), rat anti-mouse CD45 (1:50) (Abcam, Cambridge, UK), rabbit anti-GFP (1:100) (Abcam, Cambridge, UK), or rabbit
Techniques: Transplantation Assay, Expressing, Software, Immunofluorescence, Staining, Confocal Microscopy